Review



alt-r hdr donor oligos  (Integrated DNA Technologies)


Bioz Verified Symbol Integrated DNA Technologies is a verified supplier
Bioz Manufacturer Symbol Integrated DNA Technologies manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 92
      Buy from Supplier

    Structured Review

    Integrated DNA Technologies alt-r hdr donor oligos
    Alt R Hdr Donor Oligos, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 92/100, based on 50 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/alt-r+hdr+donor+oligos/Alt-R+HDR+Donor+Oligos/custom%40alt-r-hdr-donor-oligos%4042574251
    Average 92 stars, based on 50 article reviews
    alt-r hdr donor oligos - by Bioz Stars, 2026-10
    92/100 stars

    Images

    Related Articles

    Sequencing:

    Article Title: Caspase-3 cleaves CYLD to restrict interferon signaling during mitochondrial apoptosis.
    Article Snippet: reports © The Author(s) © The Author(s) EMBO reports 9 10 EMBO reports © The Author(s) R™ S.p. HiFi Cas9 nuclease V3, IDT), sgRNA targeting CYLD exon 8 (GTCAACAGAAGACCCATTTA, Alt-R™ CRISPR-Cas9 sgRNA, IDT), and HDR template (CCTGGAAATAGAAACAGATCTGAATTATTTTATACCTTGAATGGCTCTTCTGTTGCCTCACAACCACAATCCAAATCAAAAAATACATGGTACATTG, AltR™ HDR Donor Oligos, IDT). To prevent the CRISPR/Cas9 system from re-cutti

    Variant Assay:

    Article Title: Caspase-3 cleaves CYLD to restrict interferon signaling during mitochondrial apoptosis.
    Article Snippet: reports © The Author(s) © The Author(s) EMBO reports 9 10 EMBO reports © The Author(s) R™ S.p. HiFi Cas9 nuclease V3, IDT), sgRNA targeting CYLD exon 8 (GTCAACAGAAGACCCATTTA, Alt-R™ CRISPR-Cas9 sgRNA, IDT), and HDR template (CCTGGAAATAGAAACAGATCTGAATTATTTTATACCTTGAATGGCTCTTCTGTTGCCTCACAACCACAATCCAAATCAAAAAATACATGGTACATTG, AltR™ HDR Donor Oligos, IDT). To prevent the CRISPR/Cas9 system from re-cutti

    CRISPR:

    Article Title: Caspase-3 cleaves CYLD to restrict interferon signaling during mitochondrial apoptosis.
    Article Snippet: reports © The Author(s) © The Author(s) EMBO reports 9 10 EMBO reports © The Author(s) R™ S.p. HiFi Cas9 nuclease V3, IDT), sgRNA targeting CYLD exon 8 (GTCAACAGAAGACCCATTTA, Alt-R™ CRISPR-Cas9 sgRNA, IDT), and HDR template (CCTGGAAATAGAAACAGATCTGAATTATTTTATACCTTGAATGGCTCTTCTGTTGCCTCACAACCACAATCCAAATCAAAAAATACATGGTACATTG, AltR™ HDR Donor Oligos, IDT). To prevent the CRISPR/Cas9 system from re-cutti

    RNA sequencing:

    Article Title: Caspase-3 cleaves CYLD to restrict interferon signaling during mitochondrial apoptosis.
    Article Snippet: reports © The Author(s) © The Author(s) EMBO reports 9 10 EMBO reports © The Author(s) R™ S.p. HiFi Cas9 nuclease V3, IDT), sgRNA targeting CYLD exon 8 (GTCAACAGAAGACCCATTTA, Alt-R™ CRISPR-Cas9 sgRNA, IDT), and HDR template (CCTGGAAATAGAAACAGATCTGAATTATTTTATACCTTGAATGGCTCTTCTGTTGCCTCACAACCACAATCCAAATCAAAAAATACATGGTACATTG, AltR™ HDR Donor Oligos, IDT). To prevent the CRISPR/Cas9 system from re-cutti

    Ligation:

    Article Title: Caspase-3 cleaves CYLD to restrict interferon signaling during mitochondrial apoptosis.
    Article Snippet: reports © The Author(s) © The Author(s) EMBO reports 9 10 EMBO reports © The Author(s) R™ S.p. HiFi Cas9 nuclease V3, IDT), sgRNA targeting CYLD exon 8 (GTCAACAGAAGACCCATTTA, Alt-R™ CRISPR-Cas9 sgRNA, IDT), and HDR template (CCTGGAAATAGAAACAGATCTGAATTATTTTATACCTTGAATGGCTCTTCTGTTGCCTCACAACCACAATCCAAATCAAAAAATACATGGTACATTG, AltR™ HDR Donor Oligos, IDT). To prevent the CRISPR/Cas9 system from re-cutti

    FACS:

    Article Title: Caspase-3 cleaves CYLD to restrict interferon signaling during mitochondrial apoptosis.
    Article Snippet: reports © The Author(s) © The Author(s) EMBO reports 9 10 EMBO reports © The Author(s) R™ S.p. HiFi Cas9 nuclease V3, IDT), sgRNA targeting CYLD exon 8 (GTCAACAGAAGACCCATTTA, Alt-R™ CRISPR-Cas9 sgRNA, IDT), and HDR template (CCTGGAAATAGAAACAGATCTGAATTATTTTATACCTTGAATGGCTCTTCTGTTGCCTCACAACCACAATCCAAATCAAAAAATACATGGTACATTG, AltR™ HDR Donor Oligos, IDT). To prevent the CRISPR/Cas9 system from re-cutti

    Isolation:

    Article Title: Caspase-3 cleaves CYLD to restrict interferon signaling during mitochondrial apoptosis.
    Article Snippet: reports © The Author(s) © The Author(s) EMBO reports 9 10 EMBO reports © The Author(s) R™ S.p. HiFi Cas9 nuclease V3, IDT), sgRNA targeting CYLD exon 8 (GTCAACAGAAGACCCATTTA, Alt-R™ CRISPR-Cas9 sgRNA, IDT), and HDR template (CCTGGAAATAGAAACAGATCTGAATTATTTTATACCTTGAATGGCTCTTCTGTTGCCTCACAACCACAATCCAAATCAAAAAATACATGGTACATTG, AltR™ HDR Donor Oligos, IDT). To prevent the CRISPR/Cas9 system from re-cutti

    Incubation:

    Article Title: Caspase-3 cleaves CYLD to restrict interferon signaling during mitochondrial apoptosis.
    Article Snippet: reports © The Author(s) © The Author(s) EMBO reports 9 10 EMBO reports © The Author(s) R™ S.p. HiFi Cas9 nuclease V3, IDT), sgRNA targeting CYLD exon 8 (GTCAACAGAAGACCCATTTA, Alt-R™ CRISPR-Cas9 sgRNA, IDT), and HDR template (CCTGGAAATAGAAACAGATCTGAATTATTTTATACCTTGAATGGCTCTTCTGTTGCCTCACAACCACAATCCAAATCAAAAAATACATGGTACATTG, AltR™ HDR Donor Oligos, IDT). To prevent the CRISPR/Cas9 system from re-cutti

    Knock-In:

    Article Title: Caspase-3 cleaves CYLD to restrict interferon signaling during mitochondrial apoptosis.
    Article Snippet: reports © The Author(s) © The Author(s) EMBO reports 9 10 EMBO reports © The Author(s) R™ S.p. HiFi Cas9 nuclease V3, IDT), sgRNA targeting CYLD exon 8 (GTCAACAGAAGACCCATTTA, Alt-R™ CRISPR-Cas9 sgRNA, IDT), and HDR template (CCTGGAAATAGAAACAGATCTGAATTATTTTATACCTTGAATGGCTCTTCTGTTGCCTCACAACCACAATCCAAATCAAAAAATACATGGTACATTG, AltR™ HDR Donor Oligos, IDT). To prevent the CRISPR/Cas9 system from re-cutti

    Recombinant:

    Article Title: Caspase-3 cleaves CYLD to restrict interferon signaling during mitochondrial apoptosis.
    Article Snippet: reports © The Author(s) © The Author(s) EMBO reports 9 10 EMBO reports © The Author(s) R™ S.p. HiFi Cas9 nuclease V3, IDT), sgRNA targeting CYLD exon 8 (GTCAACAGAAGACCCATTTA, Alt-R™ CRISPR-Cas9 sgRNA, IDT), and HDR template (CCTGGAAATAGAAACAGATCTGAATTATTTTATACCTTGAATGGCTCTTCTGTTGCCTCACAACCACAATCCAAATCAAAAAATACATGGTACATTG, AltR™ HDR Donor Oligos, IDT). To prevent the CRISPR/Cas9 system from re-cutti

    Gene Knock-In:

    Article Title: Caspase-3 cleaves CYLD to restrict interferon signaling during mitochondrial apoptosis.
    Article Snippet: reports © The Author(s) © The Author(s) EMBO reports 9 10 EMBO reports © The Author(s) R™ S.p. HiFi Cas9 nuclease V3, IDT), sgRNA targeting CYLD exon 8 (GTCAACAGAAGACCCATTTA, Alt-R™ CRISPR-Cas9 sgRNA, IDT), and HDR template (CCTGGAAATAGAAACAGATCTGAATTATTTTATACCTTGAATGGCTCTTCTGTTGCCTCACAACCACAATCCAAATCAAAAAATACATGGTACATTG, AltR™ HDR Donor Oligos, IDT). To prevent the CRISPR/Cas9 system from re-cutti

    T-Test:

    Article Title: Caspase-3 cleaves CYLD to restrict interferon signaling during mitochondrial apoptosis.
    Article Snippet: reports © The Author(s) © The Author(s) EMBO reports 9 10 EMBO reports © The Author(s) R™ S.p. HiFi Cas9 nuclease V3, IDT), sgRNA targeting CYLD exon 8 (GTCAACAGAAGACCCATTTA, Alt-R™ CRISPR-Cas9 sgRNA, IDT), and HDR template (CCTGGAAATAGAAACAGATCTGAATTATTTTATACCTTGAATGGCTCTTCTGTTGCCTCACAACCACAATCCAAATCAAAAAATACATGGTACATTG, AltR™ HDR Donor Oligos, IDT). To prevent the CRISPR/Cas9 system from re-cutti



    Similar Products

    alt-r hdr donor oligos  (Integrated DNA Technologies)
    92
    Integrated DNA Technologies alt-r hdr donor oligos
    Alt R Hdr Donor Oligos, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/alt-r+hdr+donor+oligos/Alt-R+HDR+Donor+Oligos/custom%40alt-r-hdr-donor-oligos%4042574251
    Average 92 stars, based on 1 article reviews
    alt-r hdr donor oligos - by Bioz Stars, 2026-10
    92/100 stars
    		  Buy from Supplier
    homology repair alt r hdr donor oligo  (Danaher Inc)
    86
    Danaher Inc homology repair alt r hdr donor oligo
    Homology Repair Alt R Hdr Donor Oligo, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/alt-r+hdr+donor+oligos/bio_rxiv__2024__08__28__610186-154-22-29
    Average 86 stars, based on 1 article reviews
    homology repair alt r hdr donor oligo - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    alt r hdr donor oligo  (Danaher Inc)
    86
    Danaher Inc alt r hdr donor oligo
    Alt R Hdr Donor Oligo, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/alt-r+hdr+donor+oligos/pmc11361716-475-14-19
    Average 86 stars, based on 1 article reviews
    alt r hdr donor oligo - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    alt-r hdr donor oligos  (Thermo Fisher)
    90
    Thermo Fisher alt-r hdr donor oligos
    Alt R Hdr Donor Oligos, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/alt-r+hdr+donor+oligos/pmc10877462-161-5-24
    Average 90 stars, based on 1 article reviews
    alt-r hdr donor oligos - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    custom alt r hdr donor oligo  (Danaher Inc)
    86
    Danaher Inc custom alt r hdr donor oligo
    Custom Alt R Hdr Donor Oligo, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/alt-r+hdr+donor+oligos/pm38190099-196-77-88
    Average 86 stars, based on 1 article reviews
    custom alt r hdr donor oligo - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    alt r hdr donor oligos  (Danaher Inc)
    92
    Danaher Inc alt r hdr donor oligos
    Alt R Hdr Donor Oligos, supplied by Danaher Inc, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/alt-r+hdr+donor+oligos/Alt-R+HDR+Donor+Oligos/pmc09883431-227-19-23
    Average 92 stars, based on 1 article reviews
    alt r hdr donor oligos - by Bioz Stars, 2026-10
    92/100 stars
    		  Buy from Supplier
    repair hdr donor oligos  (Integrated DNA Technologies)
    92
    Integrated DNA Technologies repair hdr donor oligos
    Regulation of TNFSF10 expression by rs31074711 Alleles. ( A ) Depicted <t>is</t> <t>CRISPR-Cas9</t> genome editing of rs13074711 from TC genotype to CC genotype through <t>HDR.</t> DNA sequencing chromatograms showed the shift from T to C, after genome editing in HCC1806 cells. ( B ) qRT-PCR analysis of TNFSF10 mRNA in HCC1806 cells with TC or CC genotype of rs31074711 that were treated with IFN-β for 1 day. Results were normalized to RNA18S and fold induction is shown relative to the untreated control with TC genotype. ( C ) Western blot analysis of TNFSF10 protein expression in HCC1806 cells with TC or CC genotype 1-day post IFN-β treatment. Tublin was used as an endogenous loading control. ( D ) HCC1806 cells with TC or CC genotypes were treated with IFN-β and subjected to the IncuCyte Live-Cell Imaging System. Apoptosis was quantified using green fluorescent signals from caspase-3/7–positive apoptotic cells normalized to cell density. All data represent the mean and SD of n = 3–6 biological replicates and are representative of at least two independent experiments. * * * P < 0.001.
    Repair Hdr Donor Oligos, supplied by Integrated DNA Technologies, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/alt-r+hdr+donor+oligos/Alt-R+HDR+Donor+Oligos/pmc09837834-149-31-35
    Average 92 stars, based on 1 article reviews
    repair hdr donor oligos - by Bioz Stars, 2026-10
    92/100 stars
    		  Buy from Supplier

    Image Search Results


    Regulation of TNFSF10 expression by rs31074711 Alleles. ( A ) Depicted is CRISPR-Cas9 genome editing of rs13074711 from TC genotype to CC genotype through HDR. DNA sequencing chromatograms showed the shift from T to C, after genome editing in HCC1806 cells. ( B ) qRT-PCR analysis of TNFSF10 mRNA in HCC1806 cells with TC or CC genotype of rs31074711 that were treated with IFN-β for 1 day. Results were normalized to RNA18S and fold induction is shown relative to the untreated control with TC genotype. ( C ) Western blot analysis of TNFSF10 protein expression in HCC1806 cells with TC or CC genotype 1-day post IFN-β treatment. Tublin was used as an endogenous loading control. ( D ) HCC1806 cells with TC or CC genotypes were treated with IFN-β and subjected to the IncuCyte Live-Cell Imaging System. Apoptosis was quantified using green fluorescent signals from caspase-3/7–positive apoptotic cells normalized to cell density. All data represent the mean and SD of n = 3–6 biological replicates and are representative of at least two independent experiments. * * * P < 0.001.

    Journal: Human Molecular Genetics

    Article Title: An enhancer variant associated with breast cancer susceptibility in Black women regulates TNFSF10 expression and antitumor immunity in triple-negative breast cancer

    doi: 10.1093/hmg/ddac168

    Figure Lengend Snippet: Regulation of TNFSF10 expression by rs31074711 Alleles. ( A ) Depicted is CRISPR-Cas9 genome editing of rs13074711 from TC genotype to CC genotype through HDR. DNA sequencing chromatograms showed the shift from T to C, after genome editing in HCC1806 cells. ( B ) qRT-PCR analysis of TNFSF10 mRNA in HCC1806 cells with TC or CC genotype of rs31074711 that were treated with IFN-β for 1 day. Results were normalized to RNA18S and fold induction is shown relative to the untreated control with TC genotype. ( C ) Western blot analysis of TNFSF10 protein expression in HCC1806 cells with TC or CC genotype 1-day post IFN-β treatment. Tublin was used as an endogenous loading control. ( D ) HCC1806 cells with TC or CC genotypes were treated with IFN-β and subjected to the IncuCyte Live-Cell Imaging System. Apoptosis was quantified using green fluorescent signals from caspase-3/7–positive apoptotic cells normalized to cell density. All data represent the mean and SD of n = 3–6 biological replicates and are representative of at least two independent experiments. * * * P < 0.001.

    Article Snippet: For genome editing, gRNAs were designed to target the TNFSF10 enhancer region containing SNP rs13074711, which were incubated with S.p.Cas9 Nuclease V3 and transfected into TNBC cells, along with Alt-R homology-directed repair (HDR) donor oligos (IDT) for homologous recombination.

    Techniques: Expressing, CRISPR, DNA Sequencing, Quantitative RT-PCR, Western Blot, Live Cell Imaging